#!/usr/bin/perl
#-------------------------------------------------------------------------#
#               Author: Douglas Senalik dsenalik@wisc.edu                 #
#  http://www.vcru.wisc.edu/simonlab/sdata/software/index.html#contignet  #
#	Modified by: Simon Gladman simon.gladman@csiro.au		  #
#				2011					  #
#-------------------------------------------------------------------------#
# "Black Box" program series
=bb
Create a network of all interconnected 454 contigs
=cut bb
use strict;
use warnings;
use Getopt::Long;      # for getting command line parameters

# 1.0.1 - Dec 29, 2010
# 1.0.2 - Feb 15, 2011 - removed extra line that prevented count of nodes from working
# 1.0.3 - Mar 12, 2011 - Support paired end data output files, add "@" prefix for list files,
#                        add --nospline and --overlapmode parameters
# 1.0.3-Simon - May 18, 2011 - Added pseudo-links formed by paired end information instead of just
#						 newbler links	
# 1.0.4 - September 2, 2011
#         Allow "+" or "-" in contig numbers, but it is ignored
#         Add parameter to specify output image type
#         Correct error in --tag help description
#         Add --label as a synonym for --tag
#         Fix bug in dead end and recursion limit labeling
# 1.0.5 - October 18, 2011
#         Allow keeping graphviz command file
#         change default overlap mode to "false" (it was "none" before)
#         to have same default output with newest version of neato
#         make scaffold connections optional, add --scaffold to use scaffold connections
# 1.0.6 - November 4, 2011
#         Filter out null contigs, excludes, etc. from command line
#         Optional ABySS-Explorer output file added
# 1.0.7 - May 4, 2012
#         Text output data file is now sorted by contig number
#         change the --scaffold parameter to --pairlinks,
#           since I may use --scaffold in the future for the actual scaffold section
#         Show paired end links and labels ( --pairlinks ) in a different color
#         Add support for flowthrough links ( --flowthrough ) in a third color
#         Add support for flowbetween links ( --flowbetween ) in a fourth color
#         Add paired end support to ABySS-Explorer ouput, and use exclusively the
#           new ABySS-Explorer 1.3.0 .dot format
my $version            = "1.0.7";



############################################################
# configuration variables
############################################################
my $bpabbreviation       = "nt";    # set to b.p., bp, nt, or even a null string, as you prefer
my $defaultmaxlevel      = 2;
my $debuglimit           = 1000;    # how long print debug messages while extending
my $numdigits            = 5;       # contig numbers filled out with leading zeroes to this length
my $scalefactor          = 0.01;    # convert b.p. to graphviz length by multiplying by this value
my $defaultoverlapmode   = "false"; # neato overlap mode in graph section, "true" to disable
my $defaultouttype       = "png";   # default image type ( passed to neato )
my $dotheaderid          = "adj";   # ABySS-Explorer .dot file header id
my $contiggraphtxt       = "454ContigGraph.txt";  # this is defined by gsAssembler/Newbler
my $allcontigsfna        = "454AllContigs.fna";   # this is defined by gsAssembler/Newbler
my $defaultminflowbetween = 1;

# default color definitions
my $deadendcolor         = "tomato";
my $recursionlimitcolor  = "gold";
my $normallinkcolor      = "";            # leave blank for the default color of black
my $normalfontcolor      = $normallinkcolor;
my $forcedlinkcolor      = "red";         # links from --force parameter
my $forcedfontcolor      = $forcedlinkcolor;
my $pairedendlinkcolor   = "dodgerblue";  # links from paired end information
my $pairedendfontcolor   = $pairedendlinkcolor;
my $flowbetweenlinkcolor = "purple";      # links from flowthrough "F" information
my $flowbetweenfontcolor = $flowbetweenlinkcolor;
my $flowthroughlinkcolor = "forestgreen"; # links from flowthrough "I" information
my $flowthroughfontcolor = $flowthroughlinkcolor;
my $abyssk = 1;       # we don't use kmers, so set this to 1 so coverage will be direct conversion
my $abyssedge = 0;    # negative kmer minus 1, thus zero
my $abyssevalue = 0;  # we don't have a value for this, so just use zero always



############################################################
# global variables
############################################################
my $ansiup      = "\033[1A";  # terminal control
(my $prognopath = $0) =~ s/^.*[\/\\]//;
my @contiglen   = ();   # contig length
my @contigcov   = ();   # contig average coverage
my %ends        = ();   # key is contig . "3'" or "5'" or "0'", with optional "p", "f", or "i",
                        # values are @[ contig, 3'|5', #reads, flag ]
my %pairs		= ();	#used for temporary storage of paired end information until link ends can be sorted.. [Simon Gladman - 2011]
my %deadends    = ();   # key is contig, value is # of ends with reads extending ( so 1 = dead end )
my %minrl       = ();   # key is contig, value is lowest recursion level seen for this contig
my %seen        = ();   # key is contig, value is >=1 if we already traversed, undefined if not
                        #   actual value reflects recursion level when seen
my %edgeseen    = ();   # key is contig 3'or5' contig 3'or5', value = 1 or undefined
my %taghash     = ();   # key is contig, value is array of tags
my %colorhash   = ();   # key is contig, value is array of colors
my %excludehash = ();   # key is contig, value is 1 to exclude
my %inverthash  = ();   # key is contig, value is 1 to exclude
my %data        = ();   # subset of %ends that will end up in graph
my %flowdata    = ();   # store flow through read data here
my $extensions  = 0;    # number of auto-extensions so far (for --extend)
my @extarr      = ();   # extensions will apply only to supplied contigs, not auto-added ones
my $infilename  = "";   # 454ContigGraph.txt path and name
my @listofexcl  = ();   # list of excluded contigs, --listexcluded turns this on
my $deletecmdfile = 1;  # becomes 0 if a command file name is explicitly specified
my $returncode  = 0;    # return code of this program



############################################################
# command line parameters
############################################################
my $indirname   = "";   # input file name
my $outfilename = "";   # output file name
my $outtype     = $defaultouttype;  # output image file format
my $cmdfilename = "";   # graphviz .dot language command file name
my $imgfilename = "";   # image file name
my $outfastaname = "";  # create FASTA file of contigs in output
my $level       = $defaultmaxlevel;    # maximum number of levels of recursion
my $boldabove   = 0;
my @contig      = ();   # starting contig(s)
my @tag         = ();   # tag certain contigs
my @color       = ();   # color certain contigs
my @exclude     = ();   # never go into these contigs (e.g. repeat regions)
my @invert      = ();   # contigs to plot backwards
my $len         = 1;    # neato len parameter
my $listexcluded = 0;   # list contigs that have been excluded
my $extend      = 0;    # auto extend for best contig
my @forcelink   = ();   # force links where none may exist
my $showbp      = 0;    # include length in b.p. in graph
my $showcov     = 0;    # include contig average coverage in graph
my $lowlimit    = 0;    # ignore links with read limit < this
my $highlimit   = 0;    # ignore links with read number > this
my $nolabel     = 0;    # disable dead end and recursion limit labelling
my $overlapmode = $defaultoverlapmode;
my $nospline    = 0;    # to disable splines
my $scaffold    = 0;    # to enable scaffold connection information
my $pairlinks   = 0;    # to enable paired end read connection information
my $flowthrough = 0;    # to enable flowthrough connection information
my $flowbetween;        # to enable flow between connection information, has optional value also
my $alllinks    = 0;    # sets --pairlinks --flowthrough --flowbetween and --scaffold
my $abyssdotfile;       # generate file for use with ABySS-Explorer
my $help        = 0;    # print help and exit
my $quiet       = 0;    # only show errors
my $debug       = 0;    # print extra debugging information
GetOptions (
            "indir=s"        => \$indirname,         # string
            "outfile=s"      => \$outfilename,       # string
            "type=s"         => \$outtype,           # string
            "cmdfile=s"      => \$cmdfilename,       # string
            "imgfile=s"      => \$imgfilename,       # string
            "fastaout=s"     => \$outfastaname,      # string
            "abyssexplorer=s"=> \$abyssdotfile,      # string
            "level=i"        => \$level,             # integer
            "boldabove=i"    => \$boldabove,         # integer
            "contig=s"       => \@contig,            # string array
            "exclude=s"      => \@exclude,           # string array
            "invert=s"       => \@invert,            # string array
            "tag|label=s"    => \@tag,               # string array
            "color=s"        => \@color,             # string array
            "forcelink=s"    => \@forcelink,         # string array
            "len=s"          => \$len,               # real
            "extend=i"       => \$extend,            # integer
            "lowlimit=i"     => \$lowlimit,          # integer
            "highlimit=i"    => \$highlimit,         # integer
            "nolabel"        => \$nolabel,           # flag
            "nospline"       => \$nospline,          # flag
            "pairlinks"      => \$pairlinks,         # flag
            "scaffold"       => \$scaffold,          # flag
            "flowthrough"    => \$flowthrough,       # flag
            "flowbetween:s"  => \$flowbetween,       # flag/string
            "alllinks"       => \$alllinks,          # flag
            "overlapmode=s"  => \$overlapmode,       # string
            "listexcluded"   => \$listexcluded,      # flag
            "showbp|shownt"  => \$showbp,            # flag
            "showcoverage"   => \$showcov,           # flag
            "help"           => \$help,              # flag
            "quiet"          => \$quiet,             # flag
            "debug"          => \$debug);            # flag
# debug implies not quiet
if ( $debug ) { $quiet = 0; }
unless ( ( $indirname ) and ( $outfilename ) and ( scalar @contig ) ) { $help = 1; }

# changing meaning of --scaffold for future use
if ( $scaffold )
  { die "--scaffold has been changed to --pairlinks\n"; }

# $flowbetween is a flag with an optional value, set default value if no value was specified
if ( ( defined $flowbetween ) and ( $flowbetween eq "" ) ) { $flowbetween = $defaultminflowbetween; }

if ( $alllinks )
  {
    $pairlinks = 1;
    $flowthrough = 1;
    $flowbetween = $defaultminflowbetween;
    $scaffold = 1;  # future use
  }

# allow specification of only the directory
unless ( ( -d $indirname ) or ( $help ) )
  { 
    print "Error, specified input directory \"$indirname\" does not exist or is not a directory\n";
    $help = 1;
  }
$infilename = $indirname;
unless ( $infilename =~ m/\/$/ ) { $infilename .= "/"; }
$infilename .= $contiggraphtxt;

# make sure input file exists
unless ( ( -e $infilename ) or ( $help ) )
  {
    print "Error, input file \"$infilename\" does not exist\n";
    $help = 1;
  }

# if no --imgfile, create name based on --outfile
unless ( $imgfilename ) { $imgfilename = $outfilename . "." . $outtype; }
# if no --cmdfile, create name based on --outfile
if ( $cmdfilename )
  { $deletecmdfile = 0; }
else
  { $cmdfilename = $outfilename . ".graphviz"; }
if ( $outfilename =~ m/png$/i ) { warn "You probably do not want to append a .png extension on --outfile\n"; }

# OBSOLETE
# ABySS-Explorer idiosyncracy
#if ( ( $abyssexplorer ) and ( $abyssexplorer !~ m/-4.adj/ ) )
#  { print "WARNING: ABySS-Explorer versions <= 1.0.1 require that the input file name ends in \"-4.adj\"\n"; }



############################################################
# print help screen
############################################################
if ( $help )
  {
    print "$prognopath  version $version
Required parameters:
  --indir=xxx       path to 454 assembly directory
  --outfile=xxx     output text file of results
  --contig=xxx[,xxx]...
                    one or more starting contig numbers,
                    separated by comma, or multiple --contig
                    parameters may be used. Use just the
                    numeric portion of the contig
Optional parameters:
  --type=xxx        output file format, default is \"$defaultouttype\"
                    ( anything besides \"png\" is experimental )
  --cmdfile=xxx     graphviz command file in .dot language will be created
                    using this name. If not specified, a temporary command
                    file will be created, and it will be deleted when done
  --imgfile=xxx     graph image file will be created with
                    this name. If not specified, will be
                    --outfile with .${outtype} extension added
  --fastaout=xxx    create a FASTA file of all contigs in
                    the output, save in this file
  --abyssexplorer=xxx  Generate a .dot file that can be used for
                    visualization with ABySS-Explorer 1.3.0,
                    http://www.bcgsc.ca/platform/bioinfo/software/abyss-explorer";
#                    for compatibility, the file name must end in \"-4.adj\"
#                    If paired end information is available, and the
#                    --pairlinks parameter is used, corresponding
#                    \"-3.dist\" and \"-contigs.fa\" files will also be created
print "
  --flowthrough     include connection information derived from
                    reads that flow through more than two contigs
  --flowbetween[=x] include connection information derived from
                    reads that flow from one contig into another
                    by default, if the distance value is zero, it will not be
                    shown, the optional value for this parameter is a minimum
                    distance, defaulting to $defaultminflowbetween, set to --flowbetween=0 to show
                    these links also
  --pairlinks       include connection information derived
                    from paired end reads, only applicable for assemblies
                    containing paired end reads
  --alllinks        sets --flowthrough, --flowbetween, and --pairlinks
  --tag=tagname,contig[,contig]...  
                    list of 1 or more contigs will be given
                    this tag. Multiple --tag allowed.
                    tagname is a text label that will be shown
                    in the final image, e.g. --tag=\"ATP1,14,34\"
  --label           a synonym for --tag
  --showbp          show length in b.p. in graph
  --shownt          a synonym for --showbp
  --showcoverage    show average contig read coverage in graph
  --color=colorname,contig[,contig]...  
                    like --tag, but color the contig.
                    for list of valid color names see
                    http://www.graphviz.org/doc/info/colors.html
  --forcelink=xxx-5:yyy-3   force a link where none exists
                    between specified ends, xxx and yyy are
                    contig numbers
  --level=xxx       maximum recursion level, default=$level
  --boldabove=xxx   lines with read coverage >= this value
                    will be drawn in bold. no default value
  --exclude=xxx[,xxx]...
                    one or contigs to never traverse past,
                    for example a repeated region contig
  --listexcluded    print out a list of which excluded contigs
                    are being ignored
  --invert=xxx[,xxx]...
                    one or more contigs to plot backwards on
                    the graph, i.e. 3' to 5' direction
  --extend=xxx      auto extension for the single best
                    path, value is maximum steps, default=$extend
  --lowlimit=xxx    ignore connections < this number of reads
  --highlimit=xxx   ignore connections > this number of reads
  --len=xxx         len parameter to neato, default=$len
  --nolabel         disable highlighting of dead ends, and limit
                    of recursion contigs
  --overlapmode     neato paramter, default is $overlapmode, one of
                    none, true, scale
  --nospline        disable spline when edges would overlap
  --help            print this screen
  --quiet           only print error messages
  --debug           print extra debugging information

In place of lists of contigs, you can use \@filename to read in
values for that parameter from a file, e.g. --exclude=\@excl.txt

This program requires that the graphviz program \"neato\" be
available in the default PATH. The graphviz web site is
http://www.graphviz.org/
";
    exit 1;
  } # if ( $help )



############################################################
# expand --contig lists separated by commas into single array
############################################################
{
my @tmp = ();
foreach my $acontig (@contig)
  {
    $acontig = expandatprefix ( $acontig );
    push ( @tmp, split ( /\s*[,;]\s*/, $acontig ) );
  }
# cleaning and validation
@contig = ();
foreach my $item ( @tmp )
  {
    $item = expandatprefix ( $item );
    $item =~ s/^0+//;   # remove leading zeroes
    $item =~ s/\s//g;   # remove any white space
    $item =~ s/[\+\-]//g;  # allow "+" or "-" in contig numbers, but it is ignored
    if ( $item =~ m/[^\d]/ ) { die "Error, non-numeric character used for --contig \"$item\"\n"; }
    unless ( $item =~ m/^$/ )  # skip null items
      { push ( @contig, $item ); }
  }
debugmsg ( "Supplied contig list of ".scalar(@contig)." contigs = \"".join ("\" \"", @contig)."\"" );
}



############################################################
# expand --tag lists separated by commas into hash of arrays
############################################################
{
my $ntags = 0;
foreach my $atag (@tag)
  {
    my @tmp = split ( /\s*[,;]\s*/, $atag );
    my $taglabel = shift ( @tmp );
    foreach my $item ( @tmp )
      {
        $item = expandatprefix ( $item );
        $item =~ s/^0+//;  # remove leading zeroes
        unless ( $item =~ m/^$/ ) # skip null items
          {
            push ( @{$taghash{$item}}, $taglabel );
            $ntags++;
          }
      }
  } # foreach (@tag)
debugmsg ( "Stored ".commify($ntags)." tags" );
}



############################################################
# expand --color lists separated by commas into hash of arrays
############################################################
{
my $ncolors = 0;
foreach my $acolor (@color)
  {
    my @tmp = split ( /\s*[,;]\s*/, $acolor );
    my $colorlabel = shift ( @tmp );
    foreach my $item ( @tmp )
      {
        $item = expandatprefix ( $item );
        $item =~ s/^0+//;  # remove leading zeroes
        $item =~ s/[\-\+]//g;  # remove plus or minus - has no meaning, but this is a convenience to be compatible with bb.fastareorder
        unless ( $item =~ m/^$/ ) # skip null items
          {
            push ( @{$colorhash{$item}}, $colorlabel );
            $ncolors++;
          }
      }
  } # foreach (@color)
debugmsg ( "Stored ".commify($ncolors)." colors" );
}



############################################################
# expand --forcelink lists separated by commas into hash of arrays
############################################################
{
my $nforce = 0;
foreach my $aforce (@forcelink)
  {
    my @tmp = split ( /\s*[,;]\s*/, $aforce );
    foreach my $link ( @tmp )
      {
        $link = expandatprefix ( $link );
        my @parts = split ( /\s*[:-]\s*/, $link );
        unless ( scalar @parts == 4 ) { die "Invalid format for --forcelink \"$link\"\n"; }
        foreach ( @parts )
          {
            s/^0+//;   # remove leading zeroes
            s/'//g;    # remove primes (they are optional)
          }
        # add this artificial link to the list

        push ( @{$ends{$parts[0].$parts[1]."'"}}, [ $parts[2], $parts[3]."'", 0 ] );
        push ( @{$ends{$parts[2].$parts[3]."'"}}, [ $parts[0], $parts[1]."'", 0 ] );

      }
    $nforce++;
  } # foreach (@forcelink)
debugmsg ( "Stored ".commify($nforce)." forced links" );
}



############################################################
# convert --exclude lists to a simple hash
############################################################
{
foreach my $aexclude (@exclude)
  { 
    foreach my $item ( split ( /\s*[,;]\s*/, $aexclude ) )
      {
        $item = expandatprefix ( $item );
        # cleaning and validation
        $item =~ s/^0+//;   # remove leading zeroes
        $item =~ s/\s//g;   # remove any white space
        unless ( $item =~ m/^$/ ) # skip null items
          {
            if ( $item =~ m/[^\d]/ ) { die "Error, non-numeric character used for --exclude \"$item\"\n"; }
            $excludehash{$item} = 1;
          }
      }
  }
debugmsg ( "Stored ".commify(scalar keys %excludehash)." exclude contigs" );
}



############################################################
# convert --invert lists to a simple hash
############################################################
{
foreach my $ainvert (@invert)
  { 
    $ainvert = expandatprefix ( $ainvert );
    foreach my $item ( split ( /\s*[,;]\s*/, $ainvert ) )
      {
        $item = expandatprefix ( $item );
        # cleaning and validation
        $item =~ s/^0+//;   # remove leading zeroes
        $item =~ s/\s//g;   # remove any white space
        unless ( $item =~ m/^$/ ) # skip null items
          {
            if ( $item =~ m/[^\d]/ ) { die "Error, non-numeric character used for --invert \"$item\"\n"; }
            $inverthash{$item} = 1;
          }
      }
  }
debugmsg ( "Stored ".commify(scalar keys %inverthash)." invert contigs" );
}



############################################################
# parse 454ContigGraph.txt
############################################################
# sample content: refer to this excellent description for more info:
# http://contig.wordpress.com/2010/04/13/newbler-output-iii-the-454contiggraph-txt-file
#1	contig00001	588	2.6
#2	contig00002	1072	6.8
#3	contig00003	644	4.1
#...
#C	7       3'      14770   5'      3
#C	12      3'      14824   5'      5
#C	12      3'      52148   5'      4
#...
#S       1       84148   1:+;2:+;gapOneNoEdges:186;3:+;4:+;5:+;6:+
#S       2       17530   7:+
#S       3       25222   8:+;9:-;10:-;11:+;12:+;14:+;gapMultiEdges:4733;15:+;gapMultiEdges:4241;16:+;17:+;19:+
#...
#I	7       aCAACaTTATCATTGtATTTatATTCcTGTTtGAGATACGTGTGGACAGAGAATGTTGGTTTTTTGGACTAGAATCGGATTTATCATTATTATAATGT...
#I	48      AGTTCGTCCTGGACGACTTGAGTT        11:19543-5'..16159-5';6:19543-5'..60104-5'
#I	50      GGgTAATAGTTGACCGTCTTACGAAATtGGCACATTTTCTTCCAATTAACGAGAAATCTTCggtAGACAGACTAGTTCATATGTATGTGCGtGAAATC...
#...
#F	7       -       14770/3/0.0
#F	8       56895/6/0.0;54006/2/231.5       -
#F	12      -       14824/5/0.0;52148/4/0.0
#...
#P       1       10130/2/0.0;33848/3/0.0;34537/2/397.0;25104/2/679.5;15/170/698.4;6/2/1600.0;209/175/2352.0;9364/2/3929.5;19/89/4351.2;16/128/5345.5;17/25/5380.7;14/15/603...
#P       2       1/284/927.3;20341/2/7324.0;23108/2/8174.5       4/210/2787.7;3/22/3918.7;39/2/4345.5
#P       3       4/183/1037.9;24637/4/6940.0     1/156/3004.0;2/22/3918.7;1675/2/4906.0;29922/3/5867.0;97/2/6139.5;7360/2/7464.0
{
my $lines = 0;
my $clines = 0;
my $ilines = 0;
my $flines = 0;
my $slines = 0;
my $plines = 0;
my $endsstored = 0;
open ( my $INF, "<", $infilename ) or die ( "Error opening input file \"$infilename\": $!\n" );
while ( my $aline = <$INF> )
  {
    $lines++;

    # progress indicator
    unless ( $quiet ) { if ( ( $lines % 1000 ) == 0 ) { print commify($lines), "\n", $ansiup; } }

    $aline =~ s/[\r\n]//g;
    my @cols = split ( /\t/, $aline );


    if ( $cols[0] eq "C" )
      {
        $clines++;
        # store both orientations in hash
        my $keep = 1;
        if ( $cols[5] < $lowlimit ) { $keep = 0; }
        if ( ( $highlimit ) and ( $cols[5] > $highlimit ) ) { $keep = 0; }
        if ( $keep )
          {
            # store data from each end, the three columns are [0]=nextcontig [1]=5'|3'|5'p|3'p|5'f|3'f|5'i... [2]=readnum
            push ( @{$ends{$cols[1].$cols[2]}}, [ $cols[3], $cols[4], $cols[5] ] );
            # and store reciprocal end
            push ( @{$ends{$cols[3].$cols[4]}}, [ $cols[1], $cols[2], $cols[5] ] );
            $endsstored+=2;
          } # if $keep
        if ( $endsstored < $debuglimit )
          {
            my $txt = $keep?"    Storing":"Not storing";
            debugmsg ( "$txt ends: \$ends{$cols[1]$cols[2]}  [ $cols[3], $cols[4], $cols[5] ];" );
            debugmsg ( "                : \$ends{$cols[3]$cols[4]}  [ $cols[1], $cols[2], $cols[5] ];" );
          }
      } # "C"


    elsif ( $cols[0] eq "I" )  # flowthrough information
      {
        $ilines++;
        if ( $flowthrough )
          {
            # cols[1] is contig number
            # cols[2] is contig sequence ( if <= 256 b.p.)
            # cols[3] is the through-flow information, a ";" delimited list of 
            #   the format 15:1805-3'..207-3'
            # cols[3] will sometimes be null
            if ( $cols[3] )
              {
                my @parts = split ( /;/, $cols[3] );
                foreach my $apart ( @parts )
                  {
                    my @subparts = split ( /[:\-\.]/, $apart );
                    # @subparts columns become [0]=15 [1]=1805 [2]=3' [3]=null [4]=207 [5]=3'
                    push ( @{$ends{$cols[1]."0'"."i"}}, [ $subparts[1], $subparts[2], $subparts[0] ] );
                    push ( @{$ends{$cols[1]."0'"."i"}}, [ $subparts[3], $subparts[4], $subparts[0] ] );
                  } # foreach @leftparts
              } # if ( $cols[3] )
          } # if ( $flowthrough )
      } # "I"


    elsif ( $cols[0] eq "F" )  # flowbetween information
      {
        $flines++;
        if ( defined $flowbetween )
          {
            # cols[1] is contig number
            # cols[2] is flow information for reads flowing from the 5' end of the contig
            # cols[3] is flow information for reads flowing from the 3' end of the contig
            my @leftparts = split ( /;/, $cols[2] );
            my @rightparts = split ( /;/, $cols[3] );
            # each part is of the format xx/yy/z.z where xx=contig yy=number of reads z.z=distance in b.p.
            if ( $cols[2] ne "-" )  # "-" is the indicator for null entry
              {
                foreach my $apart ( @leftparts )
                  {
                    my @subparts = split ( /\//, $apart );
                    # this, and paired links is the only case where we save a fourth column in
                    # the %ends hash, a distance in b.p. value
                    # $flowbetween is also used as a minimum distance cutoff for filtering, so
                    # filter by this distance value, and ignore if too short
                    if ( $subparts[2] >= $flowbetween )
                      { push ( @{$ends{$cols[1]."5'f"}}, [ $subparts[0], "0'", $subparts[1], $subparts[2] ] ); }
                  } # foreach @leftparts
              } # if ne "-"
            if ( $cols[3] ne "-" )  # "-" is the indicator for null entry
              {
                foreach my $apart ( @rightparts )
                  {
                    my @subparts = split ( /\//, $apart );
                    if ( $subparts[2] >= $flowbetween )
                      { push ( @{$ends{$cols[1]."3'f"}}, [ $subparts[0], "0'", $subparts[1], $subparts[2] ] ); }
                  } # foreach @leftparts
              } # if ne "-"
          } # if ( defined $flowbetween )
      } # "F"


    elsif ( $cols[0] eq "S" )
      {
        $slines++;
      } # "S"


    elsif ( $cols[0] eq "P" )
      {
		$plines++;
		if ( $pairlinks ) {
			my $con_number = $cols[1];
			my $fiveprime_connects = $cols[2];
			my $threeprime_connects = $cols[3];
			my @tmp = split ";", $fiveprime_connects;
			foreach my $connection (@tmp){
				#now split up the connection.
				next if $connection eq "-";
				my @x = split "/", $connection;
				my $termcontig = $x[0];
				my $num_connects = $x[1];
				my $distance = $x[2];
				if($num_connects >= $lowlimit){
					#store in temp pairs var and search through later for termcontig details.
					push( @{$pairs{$con_number}}, [ $termcontig, "5'", $num_connects, $distance ] );
					$endsstored += 2;
					if ( $endsstored < $debuglimit )
						{
							debugmsg ( "Storing ends: \$ends{".$con_number."3'p} [ $termcontig, 5', $num_connects];" );
							debugmsg ( "                : \$ends{".$termcontig."5'p} [ $con_number, 3', $num_connects];" );
	               		}
				}
			}
			@tmp = split ";", $threeprime_connects;
			foreach my $connection (@tmp){
				#now split up the connection
				next if $connection eq "-";
				my @x = split "/", $connection;
				my $termcontig = $x[0];
				my $num_connects = $x[1];
				my $distance = $x[2];
				if($num_connects >= $lowlimit){
					#store in temp pairs var and search through later for termcontig details.
					push( @{$pairs{$con_number}}, [ $termcontig, "3'", $num_connects, $distance ] );
					$endsstored += 2;
					if ( $endsstored < $debuglimit )
						{
							debugmsg ( "Storing ends: \$ends{".$con_number."3'p} [ $termcontig, 5', $num_connects];" );
							debugmsg ( "                : \$ends{".$termcontig."5'p} [ $con_number, 3', $num_connects];" );
	       		        }
				}
			}
		} # if ( $pairlinks )
      } # "P"


    elsif ( $cols[0] =~ m/^\d+$/ )  # first section of file
      {
        $contiglen[$cols[0]] = $cols[2];
        $contigcov[$cols[0]] = $cols[3];
      } # section 1


    else
      {
        die ( "Error on line $lines of file \"$infilename\", unknown type of content:\n$aline\n" );
      }

  } # while <$INF>
close $INF;


debugmsg ( commify($lines) . " lines read from input file \"$infilename\"" );
debugmsg ( commify($#contiglen) . " contig lengths were stored" );
debugmsg ( commify($clines) . " \"C\" lines were found" );
debugmsg ( commify($endsstored) . " ends were stored" );
debugmsg ( commify($ilines) . " \"I\" lines were found" );
debugmsg ( commify($flines) . " \"F\" lines were found" );
debugmsg ( commify($plines) . " \"P\" lines were found" );
debugmsg ( commify($slines) . " \"S\" lines were found (and ignored)" );
}



############################################################
# make paired end information links
############################################################
# Added by Simon Gladman - CSIRO - 2011
# Adds paired end links to the link data variable "%ends"
foreach my $key (keys %pairs){
	my @contig = @{$pairs{$key}};
	foreach my $tmp (@contig){
		my @x = @{$tmp};
		my $term_contig = $x[0];

		my @tcontig;  # 10/11/2011 is this a bug? occassional not defined state here
		if ( $pairs{$term_contig} ) { @tcontig = @{$pairs{$term_contig}}; } # end of fix
		#my @tcontig = @{$pairs{$term_contig}};

		foreach my $ttmp (@tcontig){
			my @y = @{$ttmp};
			if($y[0] == $key){
				
				push( @{$ends{$key."$x[1]"."p"}}, [ $term_contig, "$y[1]", $x[2], $x[3] ] );
				push( @{$ends{$term_contig."$y[1]"."p"}}, [ $key, "$x[1]", $y[2], $y[3] ] );
				last;
			}
		}
	}
}



############################################################
# sort data
############################################################
# sort data so that higher read coverage links come first
# sorting is only needed if we will automatically extend network
if ( $extend )
  {
    # extend applies only to command line contigs and not auto-generated ones
    foreach ( @contig )
      { push ( @extarr, $extend ) }  # but the $extend value just evaluates to "true" later
    debugmsg ( "--extend=$extend, Sorting data" );
    foreach my $key ( keys %ends )
      {
        @{$ends{$key}} = sort {$b->[2] <=> $a->[2]} @{$ends{$key}};
      } # foreach my $key ( keys %ends )
    debugmsg ( "Extend contig list of ".scalar(@extarr)." contigs" );
  } # if ( $extend )



############################################################
# dead end detection
############################################################
# dead ends are contigs which might have reads extending to another contig
# from either the 5' or 3' end, but not both. Both ends could be dead ends, too.
# %deadends{contigid} is # of ends extending, so 1 = dead end,
# 2 = continues both ends, 0=isolated contig without any connections
unless ( $nolabel )
  {
    debugmsg ( "Dead end detection" );
    foreach my $key ( keys %ends )
      {
        ( my $contig = $key ) =~ s/[530]'[pfis]?$//;  # remove 5' or 3' or 5'p etc at end of string
        # note that this version of $contig does not have leading zeroes
        $deadends{$contig}++;
        @{$ends{$key}} = sort {$b->[2] <=> $a->[2]} @{$ends{$key}};
      } # foreach my $key ( keys %ends )
  } # unless ( $nolabel )



############################################################
# construct network from starting point(s)
############################################################
my $totalnodes = 0;
my $index = 0;
foreach my $acontig (@contig)
  {
    my $dbgtxt = (defined $extarr[$index])?"user-defined":"auto-extend";

    debugmsg ( "Contig #".($index+1)."=$dbgtxt, Recursion starting at \"$acontig\"" );
    # when hit end of our specified contigs
    unless ( defined $extarr[$index] )
      {
        if ( $extend ) { debugmsg ( "At end of specified contigs, turning off extend" ); }
        $extend = 0;
      }
    recurse ( $acontig, "", "", 0, $extend );
    $index++;
  } # foreach my $acontig (@contig)
unless ( $quiet ) { print commify($totalnodes), " nodes present in output\n"; }



############################################################
sub recurse { my ( $startcontig, $camefrom, $fromend, $recurselevel, $followlevel ) = @_;
############################################################
  unless ( $totalnodes > $debuglimit ) { debugmsg ( "recurse \"$startcontig\", camefrom=\"$camefrom\" end=\"$fromend\" recurselevel=$recurselevel" ); }

  # data for this contig is in @ { %ends{contig . 5'|3'|5'p|3'p|5'f|3'f|5'i... } } [0]=nextcontig [1]=5'|3'|5'p|3'p"5'f|3'f|5'i... [2]=readnum

  # store lowest recursion level seen for this contig
  unless ( $nolabel )
    {
      if ( ( ! defined $minrl{$startcontig} ) or ( $recurselevel < $minrl{$startcontig} ) )
        { $minrl{$startcontig} = $recurselevel; }
    } # unless ( $nolabel )

  # here is the limit to recursion
  my $stophere = 0;
  if ( $recurselevel > $level )
    {
      unless ( $totalnodes > $debuglimit ) { debugmsg ( "recursion for \"$startcontig\" at limit level=$level, returning" ); }
      $stophere = 1;
    }

  # return if this contig is on the exclude list
  elsif ( $excludehash{$startcontig} )
    {
      unless ( $totalnodes > $debuglimit ) { debugmsg ( "contig \"$startcontig\" on exclude list, returning" ); }
      # save information for list of excluded option
      my @row = ( $startcontig, $camefrom, $fromend );
      push ( @listofexcl, \@row );
      return 0;
## was this wrong? always return if on exclude list     $stophere = 1;
    }

  # skip return if follow allows it
  if ( ( $stophere ) and ( $followlevel < 1 ) ) { return 0; }

  # count nodes
  unless ( defined $seen{$startcontig} )
    {
      if ( $startcontig =~ m/^\s*$/ ) { die "Error, null contig in sub recurse($startcontig, $camefrom, $fromend, $recurselevel, $followlevel)\n"; }
      $seen{$startcontig} = 1;
      $totalnodes++;
    }

  foreach my $end ( "5'", "3'", "5'p", "3'p", "5'f", "3'f", "5'i", "3'i", "0'" )
    {
      my $first = 1;
      foreach my $contigref ( @{$ends{$startcontig.$end}} )
        {
          unless ( $totalnodes > $debuglimit ) { debugmsg ( "from \"$startcontig\" end \"$end\" find linked contig ".join(";",@$contigref) ); }

          # always skip links back to where we just came from ( and don't clear $first flag )
          if ( $contigref->[0] eq $camefrom )
            {
              unless ( $totalnodes > $debuglimit ) { debugmsg ( "\"$startcontig\": skipping link back to source contig \"$camefrom\"" ); }
              next;
            }

          # skip data storing if this edge was already stored
          unless ( defined $edgeseen{$startcontig.$end.$contigref->[0].$contigref->[1]} )
            {
              debugmsg ( "Storing in \@data at key \"$startcontig$end\": [ \"".join ( "\", \"", @$contigref )."\" ]" );
              push ( @{$data{$startcontig.$end}}, $contigref );  # $contigref is array reference

              if ( ( $first ) and ( $followlevel ) )
                {
                  unless ( $totalnodes > $debuglimit ) { debugmsg ( "auto extension following contig \"$contigref->[0]\", \$extensions=$extensions" ); }
                  $extensions++;
                  $edgeseen{$startcontig.$end.$contigref->[0].$contigref->[1]} = $recurselevel;
                  recurse ( $contigref->[0], $startcontig, $end, $recurselevel, $followlevel-1 );
                } # if
            } # unless $edgeseen
          else
            { debugmsg ( "Seen, not storing in \@data at key \"$startcontig$end\": [ \"".join ( "\", \"", @$contigref )."\" ]" ); }


          # recurse if edge seen level is higher than current level or not seen before
          if ( ( ! defined $edgeseen{$startcontig.$end.$contigref->[0].$contigref->[1]} ) or
               ( $edgeseen{$startcontig.$end.$contigref->[0].$contigref->[1]} > $recurselevel ) )
            {
              $edgeseen{$startcontig.$end.$contigref->[0].$contigref->[1]} = $recurselevel;
              recurse ( $contigref->[0], $startcontig, $end, $recurselevel+1, 0 );
            }
          $first = 0;
        } # foreach $contigref
    } # foreach $end

} # sub recurse



############################################################
# consolidate pairs of flow between links
############################################################
collapseflowbetween();



############################################################
# create output table text file
############################################################
createoutputtable();



############################################################
# generate optional ABySS-Explorer .dot file
############################################################
if ( $abyssdotfile ) { createabyssfile(); }



############################################################
# generate optional FASTA file
############################################################
if ( $outfastaname ) { createfastafile(); }



############################################################
# create graphviz command file (.dot file)
############################################################
my $savednodes = 0;
my $savededges = 0;
debugmsg ( "Creating graphviz command file \"$cmdfilename\"" );
open ( my $OUTF, ">", $cmdfilename ) or die ( "Error creating graphviz command file \"$cmdfilename\": $!\n" );
print $OUTF "graph G\n";
print $OUTF "  {\n";
print $OUTF "    edge [len=$len];\n";
my $splinemode = $nospline?"false":"true";
print $OUTF "    graph [overlap=$overlapmode,splines=$splinemode];\n";
print $OUTF "    node [shape=plaintext];\n";

# table of nodes
print $OUTF "\n    // Nodes\n";
foreach my $seencontig ( keys %seen )
  {
    my $contigid = sprintf ("%0${numdigits}d", $seencontig);

    # box is proportional to size, except if contig is small,
    # the box is still as large as the labels it contains
    my $scaledcontiglen = sprintf ( "%1d", $contiglen[$seencontig] * $scalefactor );

    # define the box representing the contig, implemented as a table in HTML
    print $OUTF "    c$contigid [label=< <TABLE BORDER=\"1\" CELLBORDER=\"0\" CELLSPACING=\"0\" CELLPADDING=\"0\"";
    if ( $colorhash{$seencontig}->[0] ) { print $OUTF " BGCOLOR=\"$colorhash{$seencontig}->[0]\""; }

    # top row is always present
    print $OUTF "><TR>";
    if ( $inverthash{$seencontig} )
      { print $OUTF "<TD PORT=\"R\">3'</TD>"; }
    else
      { print $OUTF "<TD PORT=\"L\">5'</TD>"; }
    print $OUTF "<TD PORT=\"C\" WIDTH=\"$scaledcontiglen\"";
    print $OUTF ">c$contigid</TD>";
    if ( $inverthash{$seencontig} )
      { print $OUTF "<TD PORT=\"L\">5'</TD>"; }
    else
      { print $OUTF "<TD PORT=\"R\">3'</TD>"; }
    print $OUTF "</TR>";

    # optional table row for contig size
    if ( $showbp )
      { print $OUTF "<TR><TD COLSPAN=\"3\">",commify($contiglen[$contigid])," $bpabbreviation</TD></TR>"; }

    # optional table row for coverage
    if ( $showcov )
      { print $OUTF "<TR><TD COLSPAN=\"3\">cov=",commify($contigcov[$contigid]),"</TD></TR>"; }

    # one or more optional rows for labels specified on the command line
    if ( $taghash{$seencontig}->[0] )
      {
        foreach my $tag ( @{$taghash{$seencontig}} )
          { print $OUTF "<TR><TD COLSPAN=\"3\">$tag</TD></TR>"; }
      }

    # optional final rows for dead end contigs, or recursion limit contigs
    unless ( $nolabel )
      {
        if ( ( ! defined $deadends{$seencontig} ) or ( $deadends{$seencontig} <= 1 ) )
          { print $OUTF "<TR><TD COLSPAN=\"3\" BGCOLOR=\"$deadendcolor\">Dead End</TD></TR>"; }
        if ( ( defined $minrl{$seencontig} ) and ( $minrl{$seencontig} >= $level ) )
          { print $OUTF "<TR><TD COLSPAN=\"3\" BGCOLOR=\"$recursionlimitcolor\">Recursion limit</TD></TR>"; }
      } # unless ( $nolabel )

    # and the end of this huge mess of HTML
    print $OUTF "</TABLE> >];\n";

  } # foreach my $seencontig ( keys %seen )
debugmsg ( "Saved ".commify($savednodes)." nodes" );

# table of edges ( connections )
print $OUTF "\n    // Adjacency Edges\n";
my %alreadydrawn = ();
foreach my $key ( keys %data )
  {
    $key =~ m/^(.*)([530]'[pfis]?)$/;
    my $srcend = $2;
    my $srccontig = sprintf ("%0${numdigits}d", $1);
    my $srclr = "C";
    if ( $srcend =~ m/5'/ ) { $srclr = "L"; }
    if ( $srcend =~ m/3'/ ) { $srclr = "R"; }
    unless ( $srclr ) { die "Error, no valid end at \"$key\"\n"; }
    if ( $savededges < $debuglimit ) { debugmsg ( "Key=\"$key\" Contig=\"$srccontig\" End=\"$srcend\" Port=\"$srclr\"" ); }
    foreach my $edgeref (@{$data{$key}})  # edgeref elements: [0]=contig(no leading 0) [1]=5'|3'|5'p|3'p|5'f|3'f|5'i... [2]=readnumber
      {
        # skip those final edges not leading to a node in the %seen list,
        # or those we have deleted by marking with "X"
        if ( ( $seen{$edgeref->[0]} ) and ( $edgeref->[1] ne "X" ) )
          {
            if ( $savededges < $debuglimit ) { debugmsg ( "Edge=[ \"$edgeref->[0]\" \"$edgeref->[1]\" \"$edgeref->[2]\" ]" ); }

            my $contigid = sprintf ("%0${numdigits}d", $edgeref->[0]);  # format for graph has leading zeroes
            my $lr = "C";
            if ( $edgeref->[1] =~ m/5'/ ) { $lr = "L"; }
            if ( $edgeref->[1] =~ m/3'/ ) { $lr = "R"; }
            unless ( $lr ) { die "Error no valid end at \"$edgeref->[0]\"\n"; }

            unless ( $alreadydrawn{$srccontig.$srclr."-".$contigid.$lr} )
              {
                my $linklabel = $edgeref->[2];
                if ( $edgeref->[3] )
                  {
                    # if the distance is 10 b.p. or greater, remove the decimal places to eliminate clutter
                    if ( $edgeref->[3] >= 10 ) { $edgeref->[3] =~ s/\..*$//; }
                    $linklabel .= "/" . $edgeref->[3] . $bpabbreviation;
                  }
                print $OUTF "    \"c$srccontig\":$srclr -- \"c$contigid\":$lr [label=\"$linklabel\"";

                # bold for high coverage links
                if ( ( $boldabove ) and ( $edgeref->[2] >= $boldabove ) ) { print $OUTF " style=bold"; }

                # specify colors of lines and labels connecting contigs
                if ( $edgeref->[2] == 0 )  # forced link
                  { print $OUTF " color=$forcedlinkcolor fontcolor=$forcedfontcolor"; }
                elsif ( ( $srcend =~ m/p/ ) or ( $edgeref->[1] =~ m/p/ ) )  # paired end link
                  { print $OUTF " color=$pairedendlinkcolor fontcolor=$pairedendfontcolor"; }
                elsif ( ( $srcend =~ m/f/ ) or ( $edgeref->[1] =~ m/f/ ) )  # flowbetween link
                  { print $OUTF " color=$flowbetweenlinkcolor fontcolor=$flowbetweenfontcolor"; }
                elsif ( ( $srcend =~ m/i/ ) or ( $edgeref->[1] =~ m/i/ ) )  # flowthrough link
                  { print $OUTF " color=$flowthroughlinkcolor fontcolor=$flowthroughfontcolor"; }
                else  # if $normallinkcolor is a null string, don't specify any color, use default of black
                  {
                    if ( $normallinkcolor ) { print $OUTF " color=$normallinkcolor"; }
                    if ( $normalfontcolor ) { print $OUTF " fontcolor=$normalfontcolor"; }
                  }

                print $OUTF "];\n";
                $alreadydrawn{$contigid.$lr."-".$srccontig.$srclr} = 1;  # note we store in reverse orientation here
                $savededges++;
              }
          }
      } # foreach my $edgeref (@$arrayref)
  } # foreach my $arrayref ( keys %data )
debugmsg ( "Saved ".commify($savededges)." edges" );
print $OUTF "  }\n";
close $OUTF;



############################################################
# run graphviz program neato
############################################################
my $cmd = "neato -T${outtype} -o\"$imgfilename\" \"$cmdfilename\"";
debugmsg ( "running command \"$cmd\"" );
my $result = system ( $cmd );
if ( $result )
  {
    print "Problem creating image. Error code $result returned from command \"$cmd\"\n";
    $returncode = $result;
  }
else
  {
    unless ( $quiet )
      { print "Success\n"; }
  }

# remove graphviz command file
if ( $deletecmdfile ) { unlink $cmdfilename; }



############################################################
# print out list of excluded contigs
############################################################
if ( $listexcluded )
  {
    print "List of excluded contigs\n";
    print "Contig\tLinked from\tFrom End\n";
    foreach my $rowref ( @listofexcl )
      { print join ( "\t", @{$rowref} ), "\n"; }
  } # if ( $listexcluded )



############################################################
# end of program
############################################################
exit $returncode;



############################################################
sub collapseflowbetween {
############################################################
# flowbetween links do not have a ending end, so are designated 0' there,
# but since they come in pairs, we can figure out the ends that way
# and consolidate the two links into one to eliminate clutter
# global variables (command line parameters) used:
#   
# other global variables uses
#   %data

my %finder;

# first step is to create an index
foreach my $key ( keys %data )
  {
    next unless ( $key =~ m/f/ );
    unless ( $key =~ m/^(.*)([530]'[pfis]?)$/ ) { die "Program bug parsing key \"$key\"\n"; }
    my $srcend = $2;
    my $srccontig = $1; #sprintf ("%0${numdigits}d", $1);
    foreach my $edgeref (@{$data{$key}})  # [0]contig(no leading 0) [1]5'|3'|5'p|3'p|5'f|3'f|5'i... [2]readnumber [3]distance
      {
        if ( $edgeref->[1] =~ m/0'/ )
          {
            my $bothkey = $srccontig . ":" . $edgeref->[0] . ":" . $edgeref->[3]; # omit source end in this key
            debugmsg ( "Save collapsible reference \"$bothkey\" from key \"$key\"" );
            # save the source end as array element [4]
            $edgeref->[4] = $srcend;
            push ( @{$finder{$bothkey}}, $edgeref );
          }
      } # foreach $edgeref
  } # foreach my $key ( keys %data )

# second step is to check the index for unique reciprocal links
foreach my $key ( keys %data )
  {
    next unless ( $key =~ m/f/ );
    unless ( $key =~ m/^(.*)([530]'[pfis]?)$/ ) { die "Program bug parsing key \"$key\"\n"; }
    my $srcend = $2;
    my $srccontig = $1;
    foreach my $edgeref (@{$data{$key}})  # [0]contig(no leading 0) [1]5'|3'|5'p|3'p|5'f|3'f|5'i... [2]readnumber [3]distance
      {
        my $bothkey = $srccontig . ":" . $edgeref->[0] . ":" . $edgeref->[3];
        my $reversekey = $edgeref->[0] . ":" . $srccontig . ":" . $edgeref->[3];

        if ( ( $finder{$bothkey} ) and ( $finder{$reversekey} ) )
          {
            # if by chance multiple matches, do not merge links
            if ( ( scalar @{$finder{$bothkey}} == 1 ) and ( scalar @{$finder{$reversekey}} == 1 ) )
              {
                debugmsg ( "Collapsing link \"$bothkey\" <=> \"$reversekey\"" );
                my @parts = split ( /:/, $bothkey );
                # look up the correct other end of this link from the other member of the reciprocal pair
                my $correctotherend = $finder{$reversekey}->[0]->[4];
                # save new link
                push @{$data{$key}}, [ $edgeref->[0], $correctotherend, $edgeref->[2], $edgeref->[3] ];
                # set flag on old links to indicate that they should be ignored later
                # the value from %finder is a reference back to the $edgeref from %data,
                # so here we are modifying the %data hash indirectly
                $finder{$bothkey}->[0]->[1] = "X";
                $finder{$reversekey}->[0]->[1] = "X";

                # finished processing, remove both original links from %finder hash
                # to avoid hitting the same link again in the reverse orientation
                undef ( $finder{$bothkey} );
                undef ( $finder{$reversekey} );
              }
            else
              { debugmsg ( "Ignoring multiple collapsible links for \"$bothkey\" or \"$reversekey\"" ); }
          }
      } # foreach $edgeref
  } # foreach my $key ( keys %data )
} # sub collapseflowbetween



############################################################
sub createoutputtable {
############################################################
# global variables (command line parameters) used:
#   $outfilename, $pairlinks, $flowthrough, $flowbetween, $scaffold
# other global variables uses
#   %data
my %alreadyprinted = ();
my $printededges = 0;
open ( my $OUTF, ">", $outfilename ) or die ( "Error opening output file \"$outfilename\": $!\n" );
print $OUTF join ( "\t", "#contig", "contiglen", "avg.cov.", "5'or3'", "is linked to", "5'or3'", "by read num", "contiglen", "avg.cov." );
if ( ( $pairlinks ) or ( $flowthrough ) or ( defined $flowbetween ) or ( $scaffold ) )
  { print $OUTF "\tlink type"; }
print $OUTF "\n";
foreach my $key ( sort { ($a=~m/^(\d+)[530]'/)[0] <=> ($b=~m/^(\d+)[530]'/)[0] } keys %data )
  {
    unless ( $key =~ m/^(.*)([530]'[pfis]?)$/ ) { die "Program bug, unparsable key \"$key\"\n"; }
    my $srccontig = $1;
    my $srcend = $2;
    foreach my $edgeref (@{$data{$key}})  # [0]contig(no leading 0) [1]5'|3'|5'p|3'p|5'f|3'f|5'i... [2]readnumber
      {
        unless ( ( $alreadyprinted{$srccontig.$srcend."-".$edgeref->[0].$edgeref->[1]} ) or ( $edgeref->[1] eq "X" ) )
          {
            print $OUTF join ( "\t", $srccontig, $contiglen[$srccontig], $contigcov[$srccontig],
                                     $srcend, $edgeref->[0], $edgeref->[1], $edgeref->[2],
                                     $contiglen[$edgeref->[0]], $contigcov[$edgeref->[0]] );
            if ( ( $pairlinks ) or ( $flowthrough ) or ( defined $flowbetween ) or ( $scaffold ) )
              {
                my $t = "direct";
                if ( $srcend =~ m/p/ ) { $t = "paired-end"; }
                if ( $srcend =~ m/f/ ) { $t = "flowbetween"; }
                if ( $srcend =~ m/i/ ) { $t = "flowthrough"; }
                if ( $srcend =~ m/s/ ) { $t = "scaffold"; }
                print $OUTF "\t", $t;
              }
            print $OUTF "\n";
            $alreadyprinted{$edgeref->[0].$edgeref->[1]."-".$srccontig.$srcend} = 1;  # note we store in reverse orientation here
            $printededges++;
          }
      } # foreach my $edgeref (@{$data{$key}})
  } # foreach my $arrayref ( keys %data )
debugmsg ( "Printed ".commify($printededges)." edges to output file \"$outfilename\"" );
close $OUTF;
} # sub createoutputtable



############################################################
sub createabyssfile {
############################################################
    # global variables (command line parameters) used:
    #   $abyssdotfile, $pairlinks, $flowthrough, $flowbetween, $scaffold
    # other global variables uses
    #   %data

    # collect connection data
    my %aedata;   # direct links
    my %aepdata;  # paired end links
    foreach my $key ( keys %data )
      {
        unless ( $key =~ m/^(.*)([530]'[pfis]?)$/ ) { die "Program bug parsing key \"$key\"\n"; }
        my $srccontig = $1;
        my $srcend = $2;
        debugmsg ( "AE: key=\"$key\" becomes srccontig=\"$srccontig\" srcend=\"$srcend\"" );
        foreach my $edgeref (@{$data{$key}})  # edgeref elements: [0]=contig(no leading 0) [1]=5'|3'|5'p|3'p|5'i... [2]=readnumber [3]=distance
          {
            if ( $edgeref->[1] eq "X" )  # masked entry, ignore it
              {
                debugmsg ( "AE: masked edgeref \"$edgeref->[0]\" \"$edgeref->[1]\" \"$edgeref->[2]\"" );
                next;
              }
            if ( $key !~ m/[pfis]/ )  # direct connection
              {
                my $nreads = $edgeref->[2];
                my $distance = 0;
                debugmsg ( "AE: direct edgeref \"$edgeref->[0]\" \"$edgeref->[1]\" \"$edgeref->[2]\"" );
                # values assigned here are not currently used, just the state of being defined
                $aedata{$srccontig}->{$srcend}->{$edgeref->[0]}->{$edgeref->[1]} = [ $distance, $nreads ];  # $nreads would be zero for forced links
                # if no links otherwise show up, still need a dummy line in the .adj file
                $aedata{$edgeref->[0]}->{used} = 1;
              }
            elsif ( $key =~ m/p/ )  # paired end connection
              {
                my $nreads = $edgeref->[2];
                my $distance = $edgeref->[3];
                debugmsg ( "AE: paired-end edgeref \"$edgeref->[0]\" \"$edgeref->[1]\" \"$edgeref->[2]\" \"$edgeref->[3]\"" );
                unless ( $distance ) { die "Program bug distance = \"$distance\" key $key\n"; }
                $aepdata{$srccontig}->{$srcend}->{$edgeref->[0]}->{$edgeref->[1]} = [ $distance, $nreads ];
                $aepdata{$edgeref->[0]}->{used} = 1;
              }
          } # foreach my $edgeref (@{$data{$key}})
      } # foreach my $arrayref ( keys %data )

    ##### ABySS-Explorer 1.3.0 .dot output file example lines
    # parts of the example file SRP000220-6.dot
    #digraph adj {
    #graph [k=32]
    #edge [d=-31]
    #"18+" [l=334 C=32002]
    #"18-" [l=334 C=32002]
    #...
    #"1807+" -> "1811-" [d=-706]
    #"1807+" -> "1825+" [d=-706]
    #
    # from SRP000220-6.path1.dot
    # "1861+" -> "1863+" [d=35 e=1.6 n=172]
    # "1861+" -> "1886-" [d=-13 e=1.8 n=135]

    # not sure about use of this file, not loadable SRX000430-6.dist.dot
    #digraph dist {
    #graph [k=32 s=100 n=10]
    #"18+" -> "71-" [d=320 e=2.6 n=62]

    debugmsg ( "Creating ABySS-Explorer .dot file \"$abyssdotfile\"" );
    open ( my $OUTF, ">", $abyssdotfile ) or die ( "Error creating ABySS-Explorer .dot file \"$abyssdotfile\": $!\n" );
    # start of .dot file, the header line, I don't know if other names than "adj" are valid, I didn't check
    print $OUTF "digraph $dotheaderid \{\n";
    print $OUTF "graph [k=", $abyssk, "]\n";   # this will be 1 because we don't use kmers
    print $OUTF "edge [d=", $abyssedge, "]\n";

    ### Vertices
    {

    my %list;  # make a list of just the contig numbers, but from both shotgun and paired end
    foreach my $acontig ( keys %aedata )
      {
        if ( $aedata{$acontig}->{used} )
        #$acontig =~ s/[530]'[pfis]?//;
          { $list{$acontig} = 1; }
      }
    foreach my $acontig ( keys %aepdata )
      {
        if ( $aepdata{$acontig}->{used} )
          { $list{$acontig} = 1; }
      }

    foreach my $acontig ( sort { $a <=> $b } keys %list )
      {
        # coverage must be an integer for ABySS-Explorer, so round to nearest integer
        # multiply coverage by length because ABySS-Explorer uses kmer coverage, we need to simulate that
        my $avgcov = sprintf( "%0d", ( $contigcov[$acontig] * $contiglen[$acontig] ) );
        # print contig here
        print $OUTF "\"" . $acontig . "+\" [l=" . $contiglen[$acontig] . " C=" . $avgcov . "]\n";
        print $OUTF "\"" . $acontig . "-\" [l=" . $contiglen[$acontig] . " C=" . $avgcov . "]\n";
      } # foreach my $acontig %data
    }

    ### adj pattern
    foreach my $acontig ( sort { $a <=> $b } keys %aedata )  # $acontig is just a contig number
      {
        debugmsg ( "AE: write adj data for contig \"$acontig\"" );
        foreach my $fend ( sort keys %{$aedata{$acontig}} )
          {
            next if ( $fend !~ m/\d/ ); # i.e., ne 'used'
            foreach my $rcontig ( sort { $a <=> $b } keys %{$aedata{$acontig}->{$fend}} )
              {
                foreach my $rend ( sort keys %{$aedata{$acontig}->{$fend}->{$rcontig}} )
                  {
                    # currently only use defined state, values ignored for direct connections
                    # my ( $distance, $nreads ) = @{$aepdata{$acontig}->{$fend}->{$rcontig}->{$rend}};

                    # + and - are backwards from what looks natural, so that ABySS-Explorer
                    # defaults to showing arrows 5' to 3'
                    # 3'->5' = - -  3'->3' = - +
                    # 5'->5' = + -  5'->3' = + +
                    my $fdir = ($fend=~m/5/)?"+":"-";
                    my $rdir = ($rend=~m/3/)?"+":"-";

                    # print link here
                    print $OUTF "\"${acontig}${fdir}\" -> \"${rcontig}${rdir}\"\n";
                    debugmsg ( "AE: rcontig=$rcontig pm=$rdir link is \"${acontig}${fdir}\" -> \"${rcontig}${rdir}\"" );
                  } # foreach $rend
              } # foreach $rcontig
          } # foreach $fend
      } # foreach my $acontig %aedata

    ### dist pattern
    foreach my $acontig ( sort { $a <=> $b } keys %aepdata )
      {
        debugmsg ( "AE: write dist data for contig \"$acontig\"" );
        foreach my $fend ( sort keys %{$aepdata{$acontig}} )
          {
            next if ( $fend !~ m/\d/ ); # i.e., ne 'used'
            foreach my $rcontig ( sort { $a <=> $b } keys %{$aepdata{$acontig}->{$fend}} )
              {
                if ( $fend !~ m/p/ ) { die "Program bug: \%aepdata key for $acontig has no \"p\": \"$fend\"\n"; }
                foreach my $rend ( sort keys %{$aepdata{$acontig}->{$fend}->{$rcontig}} )
                  {
                    my ( $distance, $nreads ) = @{$aepdata{$acontig}->{$fend}->{$rcontig}->{$rend}};
                    unless ( $distance ) { die "Program bug, paired end distance not defined contig $acontig end $fend to end $rcontig end $rend\n"; }

                    # 3'->5' = - -  3'->3' = - +
                    # 5'->5' = + -  5'->3' = + +
                    my $fdir = ($fend=~m/5/)?"+":"-";
                    my $rdir = ($rend=~m/3/)?"+":"-";

                    # special precise formatting needed by ABySS-Explorer
                    $distance = int ( $distance + 0.5 );  # must be integer
                    my $e = sprintf ( "%0.1f", $abyssevalue ); # units are b.p., required 1 decimal place
                    my $n = int($nreads); # n is number of mates, must be integer, here we use the number of reads, same thing

                    # print link here
                    print $OUTF "\"${acontig}${fdir}\" -> \"${rcontig}${rdir}\" [d=$distance e=$e n=$n]\n";
                    debugmsg ( "AE: write pe link \"${acontig}${fdir}\" -> \"${rcontig}${rdir}\" [d=$distance e=$e n=$n]" );
                  } # foreach $rend
              } # foreach $rcontig
          } # foreach $fend
      } # foreach my $acontig %aepdata

    # end of file
    print $OUTF "\}\n";
    close $OUTF;

} # sub createabyssfile



############################################################
sub createfastafile {
############################################################
    # global variables (command line parameters) used:
    #   $indirname, $outfastaname
    # other global variables uses
    #   %seen, $bpabbreviation
    my %fasta = ();  # store all contigs in memory
    my $fastainfilename = $indirname;
    unless ( $fastainfilename =~ m/\/$/ ) { $fastainfilename .= "/"; }
    $fastainfilename .= $allcontigsfna;
    my $lines = 0;
    my $sequences = 0;
    my $seqsaved = 0;
    my $bpsaved = 0;
    my $saveflag = 0;
    my $id = "";
    open ( my $INF, "<", $fastainfilename ) or die ( "Error opening input file \"$fastainfilename\": $!\n" );
    while ( my $aline = <$INF> )
      {
        $lines++;
        $aline =~ s/[\r\n]//g;
        if ( $aline =~ m/^>([^\s]*)/ )
          {
            $id = $1;  # up to first white space
            $id =~ s/contig0*//;  # remove "contig" and any leading zeroes
            if ( $id =~ m/^\s*$/ ) { die "Error, null contig name from line $lines of file \"$fastainfilename\"\n"; }
            $sequences++;
            $saveflag = $seen{$id};
          } # if
        if ( $saveflag )
          {
            $fasta{$id} .= $aline . "\n";
            unless ( $aline =~ m/^>/ )
              {
                $aline =~ s/[^AaCcTtGgMmRrYyKkVvHhDdBb]//g;
                $bpsaved += length ( $aline );
              }
          } # if
      } # while
    close $INF;
    unless ( $quiet )
      { print "Input FASTA file contained ", commify($lines), " lines and ", commify($sequences), " sequences\n"; }

    open ( my $OUTF, ">", $outfastaname ) or die ( "Error opening output file \"$outfastaname\": $!\n" );
    foreach my $acontig ( sort { $a <=> $b } keys %seen )
      {
        my $seq = exists($fasta{$acontig}) ? $fasta{$acontig} : "";
        if ( $seq )
          { print $OUTF $seq; }
        else
          { print "Warning, empty sequence for contig \"$acontig\"\n"; }
        $seqsaved++;
      }
    close $OUTF;
    unless ( $quiet )
      { print commify($seqsaved), " sequences, ", commify($bpsaved), " $bpabbreviation saved in \"$outfastaname\"\n"; }
  } # sub createfastafile



############################################################
sub debugmsg { my ( $text, $noreturn, $nolinenum ) = @_;
############################################################
  if ( $debug )
    {
      my ($package, $filename, $line, $sub) = caller(0);
      unless ( $nolinenum ) { $text = "Line $line: " . $text; }
      if ( ! ( $noreturn ) ) { $text .= "\n"; }
      print $text;
    } # if ( $debug )
} # sub debugmsg



###############################################################
sub expandatprefix { my ( $string ) = @_;
###############################################################
# some parameters with contigs can have "@xxx" used instead,
# the text following "@" is a filename. 
# This file contains the parameters, which will be
# substituted in. Otherwise return the string unmodified
  if ( $string =~ m/^\@(.*)$/ )
    {
      my $filename = $1;
      open my $EFILE,"<",$filename or die ( "Error opening file \"$filename\": $!\n" );
      my @contents = <$EFILE>;
      close $EFILE;
      $string = join ( ",", @contents );
      $string =~ s/[\r\n\s]//g;
    } # if ( $string =~ m/^\@/ )
  return $string;
} # sub expandatprefix



###############################################################
sub timestr {
###############################################################
  @_ = localtime(shift || time);
  return(sprintf("%04d/%02d/%02d %02d:%02d", $_[5]+1900, $_[4]+1, $_[3], @_[2,1]));
} # sub timestr



###############################################################
sub commify {
###############################################################
# http://perldoc.perl.org/perlfaq5.html#How-can-I-output-my-numbers-with-commas
  local $_ = shift;
  1 while s/^([-+]?\d+)(\d{3})/$1,$2/;
  return $_;
} # commify



# eof
=pod sample
graph G
  {
    edge [len=1];
    graph [overlap=none,splines=true];
    node [shape=plaintext];
    c12345 [label=< <TABLE BORDER="1" CELLBORDER="0" CELLSPACING="0"><TR><TD PORT="L">5'</TD><TD WIDTH="200">c12345</TD...
    c23456 [label=< <TABLE BORDER="1" CELLBORDER="0" CELLSPACING="0"><TR><TD PORT="L">5'</TD><TD WIDTH="10">c23456</TD>...
    c34567 [label=< <TABLE BORDER="1" CELLBORDER="0" CELLSPACING="0"><TR><TD PORT="L">5'</TD><TD WIDTH="1">c34567</TD><...
    c45678 [label=< <TABLE BORDER="1" CELLBORDER="0" CELLSPACING="0"><TR><TD PORT="L">5'</TD><TD WIDTH="100">c45678</TD...

    "c23456":L -- "c34567":R [label="31"];
    "c34567":L -- "c45678":R [label="12"];
    "c45678":L -- "c12345":R [label="18"];
    "c34567":L -- "c12345":R [label="1"];
  }
=end
